Publication NumberEP 1619249 B1
Assignees
  • Academisch Ziekenhuis Leiden
StatusIssued Patent
Application Number05076770
AvailabilityUnknown
Filing Date2001-09-21
Publication Date2008-09-24

Abstract

Claims

  • Use of an antisense-oligonucleotide directed against the interior of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 or 53 in a dystrophin pro-mRNA, wherein said antisense-oligonucleotide is capable of specifically inhibiting an exon inclusion signal in said exon and contains between 14-40 nucleotides, for the preparation of a medicament for directing splicing of said dystrophin pre-mRNA in a cell capable of performing a splicing operation.
  • Use according to claim 2, wherein said exon inclusion signal comprises an exon recognition sequence.
  • Use according to claim 1 or claim 2, wherein said exon inclusion signal is present in an exon comprising a strong splice donor/acceptor pair.
  • Use of an antisense-oligonucleotide directed against the interior of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 or 53 in a dystrophin pre-mRNA, wherein said antisense-oligonucleotide is capable of specifically inhibiting an exon inclusion signal in said exon and contains between 14-40 nucleotides , for producing a mutant or normal dystrophin protein.
  • Use according to claim 4, wherein said mutant dystrophin protein is equivalent to a dystrophin protein of a Becker patient.
  • Use according to any one of claims 1-5, wherein said antisense-oligonucleotide contains between 15-25 nucleotides or a functional equivalent thereof capable of specifically inhibiting an exon inclusion signal in said exon.
  • Use according to any one of claims 1-6, further comprising use of another antisense-oligonucleotide capable of inhibiting an exon inclusion signal present in another exon of said pre·mRNA and containing between 14-40 nucleotides for the preparation of a medicament for directing splicing of said dystrophin pre-mRNA.
  • A method for directing splicing of a dystrophin pre-mRNA in a cell capable of performing a splicing operation comprising contacting said dystrophin pre-mRNA in said cell in vitro with an antisense-oligonucleotide capable of specifically inhibiting an exon inclusion signal of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 or 53 in said dystrophin pre-mRNA, said oligonucleotide containing between 14-40 nucleotides, said method further comprising allowing splicing of said pre-mRNA.
  • A method according to claim 8, further comprising allowing translation of mRNA produced from splicing of said pre-mRNA.
  • A method according to claim 8 or claim 9, wherein said mRNA encodes a functional protein.
  • A method according to any one of claims 8-10, wherein said contacting results in activation of a cryptic splice site in a contacted exon.
  • A method according to any one of claims 8-11, wherein said exon inclusion signal comprises an exon recognition sequence.
  • A method according to any one of claims 8-12, wherein said exon inclusion signal is present in an exon comprising a strong splice donor/acceptor pair.
  • A method according to any one of claims 8-13, wherein said translation results in a mutant or normal dystrophin protein.
  • A method according to claim 14, wherein said mutant dystrophin protein is equivalent to a dystrophin protein of a Becker patient.
  • A method according to claim 15, wherein said antisense-oligonucleotide comprises between 15-25 nucleotides or a functional equivalent thereof capable of specifically inhibiting an exon inclusion signal in said exon.
  • A method according to any one of claims 8-16, further comprising providing said cell in vitro with another antisense-oligonucleotide capable of inhibiting an exon inclusion signal present in another exon of said pre-mRNA.
  • An antisense-oligonucleotide of between 14-40 nucleotides comprising the nucleic acid sequence hAON#4: 5' CTGCTTCCTCCAACC, hAON#6: 5' GTTATCTGCTTCCTCCAACC, hAON#8: 5' GCTTTTCTTTTAGTTGCTGC, hAON#9: 5' TTAGTTGCTGCTCTT, hAON#11: 5' TTGCTGCTCTTTTCC, hAON#21: 5' CCACAGGTTGTGTCACCAG, hAON#22: 5' TTTCCTTAGTAACCACAGGTT, hAON#23: 5' TGGCATTTCTAGTTTGG, hAON#24: 5' CCAGAGCAGGTACCTCCAACATC, hAON#25: 5' GGTAAGTTCTGTCCAAGCCC, hAON#26: 5' TCACCCTCTGTGATTTTAT, hAON#27: 5' CCCTCTGTGATTTT, hAON#28: 5' TCACCCACCATCACCCT, hAON#29: 5' TGATATCCTCAAGGTCACCC, or hAON#30: 5' CTGCTTGATGATCATCTCGTT.
  • A nucleic acid delivery vehicle comprising an antisense-oligonucleotide capable of inhibiting an exon-inclusion signal in at least one of exons 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 or 53 of a dystrophin pre-mRNA said oligonucleotide containing between 14-40 nucleotides, or the complement of said oligonucleotide.
  • A nucleic acid delivery vehicle capable of expressing an antisense-oligonucleotide according to claim 18.
  • A nucleic acid delivery vehicle according to claim 19 or claim 20, comprising a single stranded virus.
  • A nucleic acid delivery vehicle according to claim 19 or claim 20, comprising an adeno-associated virus.
  • Use of an antisense-oligonucleotide capable of inhibiting an exon-inclusion signal in at least one of exons 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 or 53 of a dystrophin pre-mRNA, said oligonucleotide containing between 14-40 nucleotides or a nucleic acid delivery vehicle according to any one of claims 19-22, for the preparation of a medicament.
  • Use of an antisense-oligonucleotide capable of inhibiting an exon-inclusion signal in at least one of exons 2, 829, 43, 44, 45, 46, 50, 51, 52 or 53 of a dystrophin pre-mRNA, said oligonucleotide containing between 14-40 nucleotides or a nucleic acid delivery vehicle according to any one of claims 19-22, for the preparation of a medicament for the treatment of an inherited disease or predisposition to a disease.
  • A non-human animal provided with an antisense-oligonucleotide capable of inhibiting an exon-inclusion signal in at least one of exons 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 or 53 of a dystrophin pre-mRNA, said oligonucleotide containing between 14-40 nucleotides.
  • A non-human animal according to claim 25, further comprising a nucleic acid encoding a human protein or a functional equivalent thereof.
  • A non-human animal according to claim 26, further comprising a silencing mutation in the gene encoding an animal homologue of said human protein.